103437918 21

103437918 21 Other isopeptide bonds, eg gamma-glutamyl and beta-alanyl, are not hydrolysed a mammalian, cytosolic enzyme.

103437918/21 procurar compreender a conflitividade das relações interpessoais na dinâmica eu/outro(a) sob o foco das relações de trabalho em instituições.

Evolutionary conserved segments in the human genome, determined by a comparative analysis with the mouse and dog genomes.

21:15068084-15069833 cg04771199 aaaaaacataaaaaaaaccacctctcccatcccccaacaaataaaaccca.

103437918 21

  • Other isopeptide bonds, eg gamma-glutamyl and beta-alanyl, are not hydrolysed a mammalian, cytosolic enzyme.

103437918 21
3/5 21